Parabricks

Learn how to use Parabricks with Cudo Compute.

Prerequisites

  • Create a project and add an SSH key
  • Optionally download CLI tool
  • Choose a VM with an NVIDIA GPU and Configure
  • Use the Ubuntu 22.04 + NVIDIA drivers + Docker image (in CLI tool type -image ubuntu-nvidia-docker)

Running Parabricks with Docker

docker pull nvcr.io/nvidia/clara/clara-parabricks:4.0.0-1

NGC tags can be found here More tutorials here (https://docs.nvidia.com/clara/parabricks/4.0.0/Tutorials.html)

Sample walkthrough

Download the sample data

wget -O parabricks_sample.tar.gz \
"https://s3.amazonaws.com/parabricks.sample/parabricks_sample.tar.gz"

Extract the data

tar xvf parabricks_sample.tar.gz
docker run \
      --gpus all \
      --rm \
      --volume $(pwd):/workdir \
      --volume $(pwd):/outputdir \
    nvcr.io/nvidia/clara/clara-parabricks:4.0.0-1 \
    pbrun fq2bam \
      --ref /workdir/parabricks_sample/Ref/Homo_sapiens_assembly38.fasta \
      --in-fq /workdir/parabricks_sample/Data/sample_1.fq.gz /workdir/parabricks_sample/Data/sample_2.fq.gz \
      --out-bam /outputdir/fq2bam_output.bam
[Parabricks Options Mesg]: Checking argument compatibility
[Parabricks Options Mesg]: Automatically generating ID prefix
[Parabricks Options Mesg]: Read group created for /workdir/parabricks_sample/Data/sample_1.fq.gz and
/workdir/parabricks_sample/Data/sample_2.fq.gz
[Parabricks Options Mesg]: @RG\tID:HK3TJBCX2.1\tLB:lib1\tPL:bar\tSM:sample\tPU:HK3TJBCX2.1
[PB Info 2022-Oct-14 09:54:15] ------------------------------------------------------------------------------
[PB Info 2022-Oct-14 09:54:15] ||                 Parabricks accelerated Genomics Pipeline                 ||
...

On a 4x NVIDIA A4000 VM this process takes around 1m 30s

To view the results run:

apt install samtools
samtools view fq2bam_output.bam
HWI-D00127:570:HK3TJBCX2:2:2215:1035:92366  77  *   0   0   *   *   0   0   NAAAGACGGAGAGCGCCAACGGCGTCCATCTCGAAGGAGTCGCCAGCGATAACCGGAGTAGTTGAAATGGTAATAAGACGACCAATCTGACCAGCAAGGAAGCCAAGATGGGAAA #<<DDHHGHHIIIIHHIIIIIIIIEHHIHHDFHIIIIIIDDEHIIIIIIIIIIHIIIIGGHD@GHHIHHIIIIIIIIIIHHHHIIHHHGHIIIHHIIIHIIHIIIIIIGIIHIII PG:Z:MarkDuplicates RG:Z:HK3TJBCX2.1    AS:i:0  XS:i:0
HWI-D00127:570:HK3TJBCX2:2:2215:21076:38154 141 *   0   0   *   *   0   0   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN ################################################################################################################### PG:Z:MarkDuplicates RG:Z:HK3TJBCX2.1    AS:i:0  XS:i:0

For more help on Parabricks see the NVIDIA docs

Want to learn more?

You can learn more about this by contacting us . Or you can just get started right away!